New pages

Jump to navigation Jump to search
New pages
Hide registered users | Hide bots | Hide redirects

14 March 2025

  • 15:2315:23, 14 March 2025 Att seq list (hist | edit) [3,928 bytes] Hggenusrwki (talk | contribs) (Created page with "== att Site Shared Sequences == Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone. <pre> >att1_shared TTTGTACAAAAAAG >att2_shared CTTTCTTGTACAAAGT >att3_shared CAACTTTATTATACA >att4_shared CAACTTTGTATAGAAAAGTTG </pre> == List of att Sites == Below are all of the att sequences (attB, P, L, and R) u...")

6 March 2025

  • 17:1417:14, 6 March 2025 PCS2FA-transposase (hist | edit) [862 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDONRP2R-P3 (hist | edit) [449 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDONRP4-P1R (hist | edit) [448 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDONR221 (hist | edit) [439 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDestTol2CG2 (hist | edit) [622 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDestTol2pA2 (hist | edit) [623 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDestTol2CG* (hist | edit) [646 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 PDestTol2pA* (hist | edit) [1,032 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 P3E-IRES-nlsEGFPpA (hist | edit) [785 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 P3E-IRES-EGFPCAAXpA (hist | edit) [644 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1317:13, 6 March 2025 P3E-IRES-EGFPpA (hist | edit) [777 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 P3E-mCherrypA (hist | edit) [874 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 P3E-EGFPpA (hist | edit) [981 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 P3E-MTpA (hist | edit) [587 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 P3E-polyA (hist | edit) [579 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 PME-mCherryCAAX (hist | edit) [1,191 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 PME-mCherry no stop (hist | edit) [700 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 PME-EGFP no stop (hist | edit) [716 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1217:12, 6 March 2025 PME-mCherryCAAX** (hist | edit) [1,099 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 17:1117:11, 6 March 2025 PME-MCS (hist | edit) [1,235 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4415:44, 6 March 2025 PME-Gal4VP16 (hist | edit) [951 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4415:44, 6 March 2025 PME-H2AmCherry (hist | edit) [642 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4415:44, 6 March 2025 PME-nlsmCherry (hist | edit) [775 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4415:44, 6 March 2025 PME-mCherryCAAX H80D** (hist | edit) [1,057 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4415:44, 6 March 2025 PME-mCherry (hist | edit) [553 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4315:43, 6 March 2025 PME-nlsEGFP (hist | edit) [606 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:4315:43, 6 March 2025 PME-EGFPCAAX (hist | edit) [671 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1815:18, 6 March 2025 PME-EGFP (hist | edit) [761 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1715:17, 6 March 2025 P5E-Fse-Asc (hist | edit) [694 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1715:17, 6 March 2025 P5E-MCS (hist | edit) [884 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1715:17, 6 March 2025 P5E-UAS (hist | edit) [1,079 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1715:17, 6 March 2025 P5E-hsp70l (hist | edit) [882 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1715:17, 6 March 2025 P5E-CMV/SP6 (hist | edit) [902 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1715:17, 6 March 2025 P5E-h2afx (hist | edit) [996 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")
  • 15:1615:16, 6 March 2025 P5E-bactin2 (hist | edit) [1,180 bytes] Hggenusrwki (talk | contribs) (Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format.")

5 March 2025

  • 17:5617:56, 5 March 2025 Full Clone List (hist | edit) [6,317 bytes] Hggenusrwki (talk | contribs) (Created page with "==List of entry and destination vectors== Here is a list of the constructs in the Tol2kit. Click on any construct name (second column) to see more information. 12/18/07: Clone pages now include annotated sequence in Genbank format. Here are insert sequences for entry clones, and 5' and 3' ends for destination clones, along with a description of how to assemble predicted sequences for expression clones. '''Constructs in the Tol2kit v1.2 (Nov 2007)'''")