P5E-Fse-Asc
Construction Details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crude Map
Screenshot from ApE showing locations of components:
Download the Sequence
- Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)