P5E-Fse-Asc

Construction Details

p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:

GGCCGGCCCTTCGGCGCGCC

that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.

Crude Map

Screenshot from Sequencher showing locations of components: P5E-UAS.png

Download the Sequence

• Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)

Download p5E-Fse-Asc

Reference

Higashijima S, Okamoto H, Ueno N, Hotta Y, Eguchi G. (1997) Dev Biol.15;192:289-99. "High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin."