P5E-Fse-Asc: Difference between revisions
Jump to navigation
Jump to search
Hggenusrwki (talk | contribs) No edit summary |
Hggenusrwki (talk | contribs) No edit summary |
||
| Line 8: | Line 8: | ||
== Crude Map == | == Crude Map == | ||
Screenshot from Sequencher showing locations of components: | Screenshot from Sequencher showing locations of components: | ||
:[[File:381 p5E-Fse-Asc.PNG|thumb|none|350px|381 p5E-Fse-Asc.PNG]] | |||
==Download the Sequence == | ==Download the Sequence == | ||
* '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | * '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | ||
: [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]] | : [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]] | ||
Revision as of 18:49, 29 May 2025
Construction Details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crude Map
Screenshot from Sequencher showing locations of components:
Download the Sequence
- Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)