P5E-Fse-Asc: Difference between revisions
Jump to navigation
Jump to search
Hggenusrwki (talk | contribs) No edit summary |
Hggenusrwki (talk | contribs) No edit summary |
||
| Line 13: | Line 13: | ||
* '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | * '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | ||
: [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]] | : [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]] | ||
Revision as of 15:35, 13 March 2025
Construction Details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crude Map
Screenshot from Sequencher showing locations of components: P5E-UAS.png
Download the Sequence
- Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)