P5E-Fse-Asc: Difference between revisions
Jump to navigation
Jump to search
Hggenusrwki (talk | contribs) Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format." |
Hggenusrwki (talk | contribs) No edit summary |
||
| Line 1: | Line 1: | ||
== Construction Details == | == Construction Details == | ||
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of: | |||
<pre> | |||
GGCCGGCCCTTCGGCGCGCC | |||
</pre> | |||
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct. | |||
== Crude Map == | == Crude Map == | ||
Screenshot from Sequencher showing locations of components: | |||
P5E-UAS.png | |||
== Sequence == | ==Download the Sequence == | ||
* Annotated Sequence | * '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | ||
: [[Media:233._pME-nlsmCherry.zip|Download p5E-Fse-Asc]] | |||
== Reference == | == Reference == | ||
Higashijima S, Okamoto H, Ueno N, Hotta Y, Eguchi G. (1997) Dev Biol.15;192:289-99. "High-frequency generation of transgenic zebrafish which | |||
reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin." | |||
Revision as of 16:30, 11 March 2025
Construction Details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crude Map
Screenshot from Sequencher showing locations of components: P5E-UAS.png
Download the Sequence
- Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)
Reference
Higashijima S, Okamoto H, Ueno N, Hotta Y, Eguchi G. (1997) Dev Biol.15;192:289-99. "High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin."