P5E-Fse-Asc: Difference between revisions
Jump to navigation
Jump to search
Hggenusrwki (talk | contribs) Created page with "== Construction Details == This template is used to display DNA sequence information in a standardized format. == Crude Map == photo showing locations of components == Sequence == * Annotated Sequence: (Genbank format) link * Full-Length Sequence with individual component sequences included: (FASTA file) link == Reference == This template is used to display DNA sequence information in a standardized format." |
No edit summary |
||
| (4 intermediate revisions by one other user not shown) | |||
| Line 1: | Line 1: | ||
== Construction Details == | == Construction Details == | ||
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of: | |||
<pre> | |||
GGCCGGCCCTTCGGCGCGCC | |||
</pre> | |||
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct. | |||
== Crude Map == | == Crude Map == | ||
Screenshot from ApE showing locations of components: | |||
:[[File:381 p5E-Fse-Asc.PNG|thumb|none|350px|381 p5E-Fse-Asc.PNG]] | |||
* Full-Length Sequence with individual component sequences included | ==Download the Sequence == | ||
* '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | |||
: [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]] | |||
Latest revision as of 19:55, 29 May 2025
Construction Details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crude Map
Screenshot from ApE showing locations of components:
381 p5E-Fse-Asc.PNG
Download the Sequence
- Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)