P5E-Fse-Asc: Difference between revisions

From tol2kit for kwan lab
Jump to navigation Jump to search
No edit summary
No edit summary
 
(3 intermediate revisions by one other user not shown)
Line 7: Line 7:


== Crude Map ==
== Crude Map ==
Screenshot from Sequencher showing locations of components:
Screenshot from ApE showing locations of components:
P5E-UAS.png
 
:[[File:381 p5E-Fse-Asc.PNG|thumb|none|350px|381 p5E-Fse-Asc.PNG]]


==Download the Sequence ==
==Download the Sequence ==
* '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file)
* '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file)
: [[Media:233._pME-nlsmCherry.zip|Download p5E-Fse-Asc]]
: [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]]
 
 
 
== Reference ==
Higashijima S, Okamoto H, Ueno N, Hotta Y, Eguchi G. (1997) Dev Biol.15;192:289-99. "High-frequency generation of transgenic zebrafish which
reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin."

Latest revision as of 19:55, 29 May 2025

Construction Details

p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:

GGCCGGCCCTTCGGCGCGCC

that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.

Crude Map

Screenshot from ApE showing locations of components:

381 p5E-Fse-Asc.PNG

Download the Sequence

  • Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)
Download p5E-Fse-Asc