P5E-Fse-Asc: Difference between revisions
Jump to navigation
Jump to search
Hggenusrwki (talk | contribs) No edit summary |
No edit summary |
||
| (3 intermediate revisions by one other user not shown) | |||
| Line 7: | Line 7: | ||
== Crude Map == | == Crude Map == | ||
Screenshot from | Screenshot from ApE showing locations of components: | ||
:[[File:381 p5E-Fse-Asc.PNG|thumb|none|350px|381 p5E-Fse-Asc.PNG]] | |||
==Download the Sequence == | ==Download the Sequence == | ||
* '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | * '''Annotated Sequence'''(Genbank format) and '''Full-Length Sequence with individual component sequences included'''(FASTA file) | ||
: [[Media: | : [[Media:381.p5E-Fse-Asc.zip|Download p5E-Fse-Asc]] | ||
Latest revision as of 19:55, 29 May 2025
Construction Details
p5E-Fse-Asc was made by PCR of two overlapping primers with att sites and the Fse and Asc recognition sites, followed by a BP reaction. The insert consists of:
GGCCGGCCCTTCGGCGCGCC
that is, an Fse then an Asc site, separated by a 4 bp spacer. Sequencing confirms that all bases of the insert are correct.
Crude Map
Screenshot from ApE showing locations of components:
381 p5E-Fse-Asc.PNG
Download the Sequence
- Annotated Sequence(Genbank format) and Full-Length Sequence with individual component sequences included(FASTA file)