Main public logs
Jump to navigation
Jump to search
Combined display of all available logs of tol2kit for kwan lab. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 15:23, 14 March 2025 Hggenusrwki talk contribs created page Att seq list (Created page with "== att Site Shared Sequences == Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone. <pre> >att1_shared TTTGTACAAAAAAG >att2_shared CTTTCTTGTACAAAGT >att3_shared CAACTTTATTATACA >att4_shared CAACTTTGTATAGAAAAGTTG </pre> == List of att Sites == Below are all of the att sequences (attB, P, L, and R) u...")