Main public logs

Combined display of all available logs of tol2kit for kwan lab. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).

• 18:32, 29 May 2025 Hggenusrwki talk contribs uploaded File:391 p3E-IRES-nlsEGFPpA.PNG
• 18:30, 29 May 2025 Hggenusrwki talk contribs created page File:390 p3E-IRES-EGFPCAAXpA.PNG
• 18:30, 29 May 2025 Hggenusrwki talk contribs uploaded File:390 p3E-IRES-EGFPCAAXpA.PNG
• 18:26, 29 May 2025 Hggenusrwki talk contribs created page File:389 p3E-IRES-EGFPpA.PNG
• 18:26, 29 May 2025 Hggenusrwki talk contribs uploaded File:389 p3E-IRES-EGFPpA.PNG
• 18:23, 29 May 2025 Hggenusrwki talk contribs created page File:388 p3E-mCherrypA.PNG
• 18:23, 29 May 2025 Hggenusrwki talk contribs uploaded File:388 p3E-mCherrypA.PNG
• 18:20, 29 May 2025 Hggenusrwki talk contribs created page File:366 p3E-EGFPpA.PNG
• 18:20, 29 May 2025 Hggenusrwki talk contribs uploaded File:366 p3E-EGFPpA.PNG
• 18:16, 29 May 2025 Hggenusrwki talk contribs created page File:229 p3E-MTpA.PNG
• 18:16, 29 May 2025 Hggenusrwki talk contribs uploaded File:229 p3E-MTpA.PNG
• 18:14, 29 May 2025 Hggenusrwki talk contribs created page File:302 p3E-polyA.PNG
• 18:14, 29 May 2025 Hggenusrwki talk contribs uploaded File:302 p3E-polyA.PNG
• 18:06, 29 May 2025 Hggenusrwki talk contribs created page File:220 pDONRP2RP3.PNG
• 18:06, 29 May 2025 Hggenusrwki talk contribs uploaded File:220 pDONRP2RP3.PNG
• 18:04, 29 May 2025 Hggenusrwki talk contribs uploaded a new version of File:219 pDONRP4P1R.PNG
• 18:03, 29 May 2025 Hggenusrwki talk contribs created page File:219 pDONRP4P1R.PNG
• 18:03, 29 May 2025 Hggenusrwki talk contribs uploaded File:219 pDONRP4P1R.PNG
• 17:59, 29 May 2025 Hggenusrwki talk contribs created page File:218 pDONR221.PNG
• 17:59, 29 May 2025 Hggenusrwki talk contribs uploaded File:218 pDONR221.PNG
• 17:53, 29 May 2025 Hggenusrwki talk contribs created page File:395 pDestTol2CG2.PNG
• 17:53, 29 May 2025 Hggenusrwki talk contribs uploaded File:395 pDestTol2CG2.PNG
• 17:50, 29 May 2025 Hggenusrwki talk contribs created page File:394 pDestTol2pA2.PNG
• 17:50, 29 May 2025 Hggenusrwki talk contribs uploaded File:394 pDestTol2pA2.PNG
• 17:35, 29 May 2025 Hggenusrwki talk contribs created page File:396 pCS2FA-Tol2transposase.PNG
• 17:35, 29 May 2025 Hggenusrwki talk contribs uploaded File:396 pCS2FA-Tol2transposase.PNG
• 17:39, 4 April 2025 Hggenusrwki talk contribs changed group membership for KmKwan from (none) to administrator
• 17:30, 4 April 2025 User account KmKwan talk contribs was created by Hggenusrwki talk contribs
• 15:27, 17 March 2025 Hggenusrwki talk contribs created page File:Opaque-clear1120.png
• 15:27, 17 March 2025 Hggenusrwki talk contribs uploaded File:Opaque-clear1120.png
• 14:54, 17 March 2025 Hggenusrwki talk contribs created page File:395.pDestTol2CG2.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:54, 17 March 2025 Hggenusrwki talk contribs uploaded File:395.pDestTol2CG2.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:53, 17 March 2025 Hggenusrwki talk contribs deleted page File:395.395.pDestTol2CG2.zip (content was: "== Summary == Annotated Sequence(gb) and Full-Length Sequence(fasta)", and the only contributor was "Hggenusrwki" (talk))
• 14:52, 17 March 2025 Hggenusrwki talk contribs created page File:395.395.pDestTol2CG2.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:52, 17 March 2025 Hggenusrwki talk contribs uploaded File:395.395.pDestTol2CG2.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:51, 17 March 2025 Hggenusrwki talk contribs deleted page File:395.pDestTol2CG2.zip (content was: "== Summary == Annotated Sequence(gb) and Full-Length Sequence(fasta)", and the only contributor was "Hggenusrwki" (talk))
• 14:49, 17 March 2025 Hggenusrwki talk contribs deleted page File:395.pDestTol2CG2.zip (Deleted old revision 20250317144850!395.pDestTol2CG2.zip: content was: "== Summary == Annotated Sequence(gb) and Full-Length Sequence(fasta)", and the only contributor was "Hggenusrwki" (talk))
• 14:48, 17 March 2025 Hggenusrwki talk contribs uploaded a new version of File:395.pDestTol2CG2.zip
• 15:33, 14 March 2025 Hggenusrwki talk contribs created page File:Favicon.png
• 15:33, 14 March 2025 Hggenusrwki talk contribs uploaded File:Favicon.png
• 15:23, 14 March 2025 Hggenusrwki talk contribs created page Att seq list (Created page with "== att Site Shared Sequences == Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone. <pre> >att1_shared TTTGTACAAAAAAG >att2_shared CTTTCTTGTACAAAGT >att3_shared CAACTTTATTATACA >att4_shared CAACTTTGTATAGAAAAGTTG </pre> == List of att Sites == Below are all of the att sequences (attB, P, L, and R) u...")
• 15:08, 14 March 2025 Hggenusrwki talk contribs created page File:456.pME-mCherry no stop.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 15:08, 14 March 2025 Hggenusrwki talk contribs uploaded File:456.pME-mCherry no stop.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 15:04, 14 March 2025 Hggenusrwki talk contribs created page File:550.pME-mCherryCAAX.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 15:04, 14 March 2025 Hggenusrwki talk contribs uploaded File:550.pME-mCherryCAAX.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 15:00, 14 March 2025 Hggenusrwki talk contribs created page File:237.pME-MCS.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 15:00, 14 March 2025 Hggenusrwki talk contribs uploaded File:237.pME-MCS.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:55, 14 March 2025 Hggenusrwki talk contribs created page File:387.pME-Gal4VP16.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:55, 14 March 2025 Hggenusrwki talk contribs uploaded File:387.pME-Gal4VP16.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))
• 14:50, 14 March 2025 Hggenusrwki talk contribs created page File:234.pME-H2AmCherry.zip (Annotated Sequence(gb) and Full-Length Sequence(fasta))