Att seq list: Revision history

Jump to navigation Jump to search

Diff selection: Mark the radio buttons of the revisions to compare and hit enter or the button at the bottom.
Legend: (cur) = difference with latest revision, (prev) = difference with preceding revision, m = minor edit.

14 March 2025

  • curprev 15:2615:26, 14 March 2025 Hggenusrwki talk contribs 3,928 bytes +4 No edit summary
  • curprev 15:2315:23, 14 March 2025 Hggenusrwki talk contribs 3,924 bytes +3,924 Created page with "== att Site Shared Sequences == Here is a set of "shared" sequences--the core stretch that is shared between attB/P/L/R for att1-4. These are useful for stitching together entry and destination sequences to calculate the sequence of a final expression clone. <pre> >att1_shared TTTGTACAAAAAAG >att2_shared CTTTCTTGTACAAAGT >att3_shared CAACTTTATTATACA >att4_shared CAACTTTGTATAGAAAAGTTG </pre> == List of att Sites == Below are all of the att sequences (attB, P, L, and R) u..."
Retrieved from "https://tol2kitkwan.genetics.utah.edu/index.php/Att_seq_list"